imran*

Blog

  • b.TWEEN07

    Btween_2

    After a week of scorching sunshine, the first day of b.TWEEN 2007 unfortunately coincided with a bout of torrential rain – and it happened to last the duration of the conference 🙁

    I missed the VIP evening (long story…) and the first sessions of Day One, but arrived to find out my old Orange colleague  JJ (Jonathan Jowitt) had booked a one-to-one session; we’ve been trying to arrange a meeting for over three years, even though we only worked a few streets apart, so this became a very expensive way for us to catch up 😉

    So, snippets from Day One…

    • I caught the breakout sessions from Matt Locke and Angel Gambino. Angel’s keynote on Strategic Serendipity struck a chord, I empathise with the trajectory of her career, what appears ‘plotted’ can indeed simply be directed good fortune. I’ve been there too 🙂 Angel serendipitously asked me the time out in the foyer…but I really needed to pee! So I never got the chance to meet her properly 🙁
    • Turns out my cousin Fozia Bano was one of the venue’s organising team – haven’t seen her in years, but she dropped into one of the auditoriums while I was waiting for the next talk…lovely to see her again!
    • Great to catchup with Yuuguu CMO, Philip Hemstead and see how the company and product are developing…they’re up at 2000+, including Wireless Grids Corp. Phil and I hung out at lunch where he introduced me to Tony Tickle of T3D. T3D have developed some neat modeling techniques for rapidly digitising city blocks…something I’m sure the Google Earth and Second Life guys might be curious about…
    • By far the most interesting segment of the day was Richard Adams and Kristina Nyzell‘s panel discussion on Open Source Business Models. The session largely focussed on Kristina’s time with LEGO and specifically how she managed their embrace of open source philosophy and the crowdsourcing of the LEGO Factory range; in its first three weeks, LEGO customers created ninety models, signalling to LEGO that their product development process needed to support and integrate evangelical customers. Curiously, Kristina related how LEGO now sees itself less as a manufacturing company and more a publishing organisation…by the way, Factory contributors are paid in bricks! Kristina and I got chatting about her new role, researching childhood and play…so I introduced her to Norman and his work on digital childhood with Frank Furedi. Oh, and Richard quoted a comment I left on one of his posts!
    • Incidentally, LEGO was also a sponsor of the conference, giving each delegate a bag of bricks to use on a collaborative model that took shape in the foyer throughout the conference…wikiLEGO!
    • William Latham and my old chums Ed French and Sam Sethi were due to speak on an technology investment panel. Sadly, the impending launch of Blognation meant Sam couldn’t make it to Bradford or his later slot at North West Startup 2.0 with Ajaz Ahmed. Ed’s posted his presentation here.

    I missed the second day – Ed and I had to meet the rest of the Ensembli team – but from my first experience of b.TWEEN, Katz has done a fantastic job not in aggregating some great speakers and sessions, but convincing them to spend a couple days in Bradford…along with the other 150-or-so delegates. Well played.

    However…I’m an O’Reilly guy – I like the freewheeling, collaborative approach of ETech, ETel and Foo – b.TWEEN is still very much a traditional conference oriented around media…there’s room for it to grow into a more contemporary unconference for the converging worlds of media, tech and innovation 🙂

  • The Batpod…

    Batmancycle
    …not some Oakley-esque remix of an iPod, but the Dark Knight‘s new ride. I want one 🙂

    More here…

  • Russell Peters – Live in NYC

    Close your eyes and he sounds just like Jimmy Smits. Russell Peters is the desi Eddie Murphy 🙂 I first saw his Comedy Now special a couple years back, but today Mohsin found some Youtube clips of a 2004 live show from NYC, much edgier than his TV stuff…

    …here’re parts 2, 3, 4, 5 & 6…enjoy 🙂

    Pra-TAAAB!

  • The Go! Team – Grip Like A Vice

    Woot! One of my favourite bands, The Go! Team has their new single, Grip Like A Vice out in a couple weeks, followed by their second album, Proof Of Youth in September. Check out the single below…

  • (* I’m praying…

    FajrTarique and I have been plotting service ideas for Believr for several months and with a lot of our family and friends now happily ensconced in Twitter and Facebook…we’re starting to think about how we can bring Believr to users in those services…

    Twitter Lingo is partially created by the user community. The D command for direct mesages was part of the official command vocabulary, but we’ve seen users very rapidly define and adopt @ for replies and L to signal your current location.

    Tarique and I are gonna suggest (* to signal when you’re praying, followed by the name of one of the five daily or optional prayers for Muslims. For example…

    • (* fajr
    • (* zohr
    • (* asr
    • (* maghrib
    • (* isha
    • (* tahajjud

    We’ll be sampiing (* from Twitter’s public timeline and attempting to visualise the results – by user, location and time where we can – over the coming days and weeks. It’ll be wonderful to see real time Islamic serendipity unfold…I’d love to get my friends at Stamen or Poly9 to plot the waves of prayer moving across the globe, following the path of the Sun, centered on Mecca 🙂

    This kinda fulfils some of our aspirations for Believr, using Muslims’ relationships to help remind themselves, and each other, of their spiritual and human responsibilities. Islamic prayer is one of the Five Pillars that underpin our faith and the cohesion of the Muslim community; by helping people pray, we hope we’re making the world a better place 🙂

    UPDATE: It’s kinda catchin’ (slooooowly)…crimsonsilk was the first user to jump in, followed by mohsin, ush and jumpy.

  • OpenCoffee Leeds {Uno}

    Opencoffee_leedsWow. Yesterday’s inaugural OpenCoffee Leeds got a turnout of twenty-seven people, much higher than I hoped and enough diversity for a palpable buzz in the room! Starbucks was kind enought to let us use a small meeting room, but with so many attendees, OpenCoffee rapidly filled the first floor of Leeds’ largest Starbucks 🙂

    The rich blend </groan> of students, entrepreneurs, academics, investors, developers and artists included…

    Andy  related that ‘everyone who I bumped into, the verdict was very
    positive. That’s what I like about these things – nobody thinks there
    will be interest, someone takes a risk, and lo & behold, it turns
    out there are plenty of people looking for community. So
    congratulations.’     {Uno} also got a shout out on a couple attendee blogs –     Inaugural OpenCoffee Leeds and Northern Grit and coffee make a good mix.

    Ian Pringle, Gang Lu, the Plusnet guys and I broke off for a separate meeting to discuss how we can bring our collective experience to help creat a sustainable tech ecosphere across the five major cities of the North.

    An interesting side discussion between Tom, Ben and Steve led to a ‘games corner’ as attendees related their interests in the local videogames ecosphere.

    All in all, a great start – I hope we can sustain the momentum for next month’s event as we build up to BarCamp Leeds later this Summer…

    { Flickr photos here… }

  • Dopplr – Travel & Serendipity

    I’ve been tinkering with Dopplr for a couple months and I’ve found it to be an app that embodies much of what I’m liking about digital design at the moment.

    I’m not traveling enough right now to really benefit from Dopplr’s  ‘increased serendipity’, but I love to just play with Dopplr, exploring aimlessly…the same kinda pleasure derived from using OS X, the iPod interface or the clean utility of the Google home page.

    Dopplr’s design is an elegant embodiment of simplicity and utility…the kind of simplicity embodied by Maeda’s Laws and we wish to employ in both Believr and mee:view. I hope we’ll do as good a job as Matt Jones, Dopplr’s Director of Design. Matt spoke about some of the influences in Dopplr’s design at Reboot 9.0  – Travel & Serendipity…

  • Previewing b.TWEEN 2007

    Btween_2Pixels, Polygons and Code return to my hometown next week with Katz Kiely’s 2007 edition of B.TWEEN, the Britain’s biggest interactive media gathering.
    This year’s themes include…

    • branding, marketing & broadcasting in the changing media landscape
    • co-design
    • online communities
    • exits for Web 2.0 startups

    There’ll be a bunch of Quickfire sessions, some workshop sessions, what looks to be a really interesting gallery of interactive works, one to one sessions with delegates 7 speakers as well as an amazing lineup of keynotes…including a few old and new chums (Charles Cecil, Sam Sethi, Ed French, Jonathan Jowitt & Peter Cowley).

    Lemme know if you’re coming, at B.TWEEN’s Facebook or Upcoming listing. See you next week 🙂

  • Leeds Met: Innovation North Showcase 2007

    InnovationnorthFifteen members of my family have variously studied PR, engineering, accountancy, software engineering and multimedia at Leeds Met. Ten years ago, I graduated from the School of Computing, now part of the Innovation North faculty.

    Serendipitously, our family descended on Leeds Met once more, last week…

    I’m accustomed to seeing the work of ITP, IDII, UC Berkeley and Media Lab up close, so it was a pleasure to be back at my alma mater and to see that the quality of the work here in Leeds is pretty good 🙂

    So what did I see…

    • wmp? Where’s My Pet: Daryl Leigh’s concept designs for a GPS+RFID pet locator were well articulated. I suggested he look for funding to create a service platform rather than the hardware…but he really wants to patent!
    • Smudge: There were a lot of record labels put together by undergraduate teams…I was surprised that few were going head on against the orthodoxies of the record industry (DRM etc.) but all, particularly Smudge (Joseph  Roberts and Richard Leadbitter), were well executed.
    • LMent: Ibtsam Shah’s Wii-esque racing game for diabetic kids at Harrogate Hospital, asks them to make ‘vroom’ noises into a mic to accelerate their cars 🙂
    • World Music Day: Students formed ‘Lead Balloon Productions’ to brand, promote and organise a music festival at the university.
    • Thackray Medical Museum: This team worked with a local museum to help them embrace web technologies in promoting the institution and forming a community.
    • VibraChair: Matthew and Lionels ‘haptic seat’ uses audio sources to help deaf people experience actiona movies. Their understanding of psycho-acoustics and haptic technology. Lionel and I talked about last month’s Wired article on Neuroplasticity. Their work has a lotta applications, I hope they continue working on it.

    Of course, this tiny slice of projects don’t do justice to the work of the school – I had two hours to get through 160 projects and I’m gutted that I didn’t get a chance to talk to the students in more depth about their ideas and plans.

    However, the limited conversations I did have highlighted a lack of industry knowledge – concepts such as Web 2.0, Mashups, Creative Commons, Interaction Design were absent from most of the student’s vocabularies. It’s perhaps a good thing, giving them a clean slate from which to explore, but also means the basic computing environment of the modern web isn’t fully appreciated…I did notice a bias towards PHP+MySQL for most software projects – this is a generational shift that’ll continue to alter the workplace wherever these graduates end up…

    Most strikingly, the Innovation North faculty was exhibiting the kind of cross-disciplinary projects that make schools like Media Lab and Ivrea really buzz; every project team was a diversity of marketeer, designer, developer, analyst and artist. With some industry participation, I think we’ll see great things from Innovation North 🙂

  • { taatacgactcactatagggaga }

    Synbio
    I’ve been fascinated by Synthetic Biology since I had my mind blown by Drew Endy‘s talk on Remixing DNA at ETech 2005.

    My friend’s impending recruitment to the OpenWetWare Lab, Google’s investment in 23andMe along with this week’s Boing Boing and O’Reilly Radar coverage of Rudy Rucker’s Our Synthetic Futures are all telling me I should be paying more attention to this subject…