Author: imran
b.TWEEN07
After a week of scorching sunshine, the first day of b.TWEEN 2007 unfortunately coincided with a bout of torrential rain – and it happened to last the duration of the conference 🙁 I missed the VIP evening (long story…) and the first sessions of Day One, but arrived to find out my old Orange colleague …
The Batpod…
…not some Oakley-esque remix of an iPod, but the Dark Knight‘s new ride. I want one 🙂 More here…
Russell Peters – Live in NYC
Close your eyes and he sounds just like Jimmy Smits. Russell Peters is the desi Eddie Murphy 🙂 I first saw his Comedy Now special a couple years back, but today Mohsin found some Youtube clips of a 2004 live show from NYC, much edgier than his TV stuff… …here’re parts 2, 3, 4, 5…
The Go! Team – Grip Like A Vice
Woot! One of my favourite bands, The Go! Team has their new single, Grip Like A Vice out in a couple weeks, followed by their second album, Proof Of Youth in September. Check out the single below…
(* I’m praying…
Tarique and I have been plotting service ideas for Believr for several months and with a lot of our family and friends now happily ensconced in Twitter and Facebook…we’re starting to think about how we can bring Believr to users in those services… Twitter Lingo is partially created by the user community. The D command…
OpenCoffee Leeds {Uno}
Wow. Yesterday’s inaugural OpenCoffee Leeds got a turnout of twenty-seven people, much higher than I hoped and enough diversity for a palpable buzz in the room! Starbucks was kind enought to let us use a small meeting room, but with so many attendees, OpenCoffee rapidly filled the first floor of Leeds’ largest Starbucks 🙂 The…
Dopplr – Travel & Serendipity
I’ve been tinkering with Dopplr for a couple months and I’ve found it to be an app that embodies much of what I’m liking about digital design at the moment. I’m not traveling enough right now to really benefit from Dopplr’s ‘increased serendipity’, but I love to just play with Dopplr, exploring aimlessly…the same kinda…
Previewing b.TWEEN 2007
Pixels, Polygons and Code return to my hometown next week with Katz Kiely’s 2007 edition of B.TWEEN, the Britain’s biggest interactive media gathering.This year’s themes include… branding, marketing & broadcasting in the changing media landscape co-design online communities exits for Web 2.0 startups There’ll be a bunch of Quickfire sessions, some workshop sessions, what looks…
Leeds Met: Innovation North Showcase 2007
Fifteen members of my family have variously studied PR, engineering, accountancy, software engineering and multimedia at Leeds Met. Ten years ago, I graduated from the School of Computing, now part of the Innovation North faculty. Serendipitously, our family descended on Leeds Met once more, last week… my brother is one of this year’s exhibiting class…
{ taatacgactcactatagggaga }
I’ve been fascinated by Synthetic Biology since I had my mind blown by Drew Endy‘s talk on Remixing DNA at ETech 2005. My friend’s impending recruitment to the OpenWetWare Lab, Google’s investment in 23andMe along with this week’s Boing Boing and O’Reilly Radar coverage of Rudy Rucker’s Our Synthetic Futures are all telling me I…