{ taatacgactcactatagggaga }

I’ve been fascinated by Synthetic Biology since I had my mind blown by Drew Endy‘s talk on Remixing DNA at ETech 2005.

My friend’s impending recruitment to the OpenWetWare Lab, Google’s investment in 23andMe along with this week’s Boing Boing and O’Reilly Radar coverage of Rudy Rucker’s Our Synthetic Futures are all telling me I should be paying more attention to this subject…