imran*

Category: Emerging Technologies

  • Fab Lab Discussion Forum

    —

    by

    imran
    in ,

    I first started following the work of Neil Gershenfeld during my various visits to MIT Media Lab, and of course through his book Fab, along with speculating about fictional HP DeskFabs and Fabster P2P networks…a miniature attempt at Bruce Sterling-eqsue Design Fiction! So it was a huge surprise to learn that Gershenfeld would be stopping…

  • Oooh Look! Pretty Computer!

    —

    by

    imran
    in

    Nicolas Negroponte‘s One Laptop Per Child project draws as much criticism as it does admiration. Much of it is valid, such as Lee Felsenstein‘s studied critiques of OLPC’s pedagogical philosophy; but sniping at the $120 hundred dollar laptop and its lo-fi technology based is missing the point. OLPC is an educational initiative not a laptop…

  • { taatacgactcactatagggaga }

    —

    by

    imran
    in

    I’ve been fascinated by Synthetic Biology since I had my mind blown by Drew Endy‘s talk on Remixing DNA at ETech 2005. My friend’s impending recruitment to the OpenWetWare Lab, Google’s investment in 23andMe along with this week’s Boing Boing and O’Reilly Radar coverage of Rudy Rucker’s Our Synthetic Futures are all telling me I…